«Иркутская государственная медицинская академия последипломного образования» icon

«Иркутская государственная медицинская академия последипломного образования»


1 чел. помогло.
Смотрите также:
Программа областной итоговой научно-практической конференции Место проведения: г. Иркутск...
Заболеваемость, инвалидность вследствие болезней костно-мышечной системы...
Научно практический центр...
И. А. Гавришевой Cанкт Петербургская медицинская академия последипломного образования...
«Санкт-петербургская медицинская академия Последипломного образования»...
«Челябинская государственная медицинская академия Росздрава»...
«Пермская государственная медицинская академия им академика Е. А. Вагнера Росздрава»...
«Тюменская государственная медицинская академия»...
«Оренбургская государственная медицинская академия»...
«Челябинская государственная медицинская академия»...
«Санкт-Петербургская медицинская академия последипломного образования Федерального агентства по...
«Санкт-Петербургская медицинская академия последипломного образования Федерального агентства по...



Загрузка...
страницы:   1   2   3
скачать
На правах рукописи


АНГАНОВА

Елена Витальевна


Условно-патогенные ЭНТЕРОБАКТЕРИИ:

доминирующие популяции, биологические свойства, медико-экологическая значимость


03.02.03-микробиология


АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук


Иркутск - 2012


Работа выполнена в ГБОУ ДПО «Иркутская государственная медицинская академия последипломного образования» Минздравсоцразвития России и ФГБУ «Научный центр проблем здоровья семьи и репродукции человека» СО РАМН


^ Научный руководитель:

доктор медицинских наук,

профессор Савилов Евгений Дмитриевич


Официальные оппоненты:


доктор биологических наук Фадеева Татьяна Владимировна


доктор биологических наук Данчинова Галина Анатольевна

доктор медицинских наук,

профессор Киклевич Вадим Трофимович


Ведущая организация:

Институт клеточного и внутриклеточного симбиоза

Уральского отделения РАН (г. Оренбург)


Защита состоится «__» _______ в ___часов на заседании Диссертационного Совета ДМ 001.038.01 при Научном центре проблем здоровья семьи и репродукции человека СО РАМН по адресу: г. Иркутск, ул. К. Маркса, 3. Почтовый адрес: 664025, г. Иркутск, а/я 539.


С диссертацией можно ознакомиться в библиотеке Научного центра проблем здоровья семьи и репродукции человека СО РАМН.


Автореферат разослан «____» ________ 2011г.


^ Ученый секретарь

Диссертационного Совета,

кандидат медицинских наук Кулеш Д.В.


Общая характеристика работы

Актуальность проблемы. В настоящее время во всех странах мира наблюдается активизация условно-патогенных микроорганизмов (УПМ) (Бондаренко В.М., 2011). Бактерии данной группы характеризуются выраженной неоднородностью, являясь, с одной стороны, представителями транзиторной нормальной микрофлоры человек, а с другой,- возбудителями инфекционных заболеваний (Марри П.Р. с соавт., 2006; Егорова, 2007; Бондаренко В.М., 2011). В связи с этим, проблеме инфекций, обусловленных УПМ, особенно представителями семейства Enterobacteriaceae, уделяется пристальное внимание (Ахтариева А.А., 2010). К числу наиболее распространенных инфекционных заболеваний относятся острые кишечные инфекции (ОКИ), занимающие одно из ведущих мест в инфекционной патологии детского возраста (Воротынцева Н.В. соавт., 2001; Жеребцова Н.Ю. с соавт., 2007; Денисюк Н.Б., 2011; Хворостухина А.И., 2011; Калуцкий П.В., 2011). Доля ОКИ, вызванных условно-патогенными энтеробактериями (УПЭ), в общей структуре ОКИ установленной этиологии, по данным разных авторов, варьирует от 12,8-21,2% до 34,1% (Зуева Л.П., 2005; Жеребцова Н.Ю., 2006).

Как отмечают А.Р. Мавзютов с соавт. (2001), С.В.Егорова (2008), В.М. Бондаренко (2011), для оценки этиологической значимости УПЭ при инфекционных процессах необходимо заключение об их патогенном потенциале, который недостаточно учитывается при верификации острых кишечных инфекций. Кроме того, масштабы изменения патогенности условно-патогенных энтеробактерий, являющиеся одной из причин увеличения их медицинской значимости, свидетельствуют о целесообразности изучения этого явления у данной группы бактерий, как на фенотипическом, так и на молекулярно-генетическом уровне (Мавзютов А.Р. с соавт., 2002; Фиалкина С.В., 2004; Жеребцова Н.Ю., 2006; Вершинин А.Е., 2008; Бондаренко В.М., 2011; Burgos Y. et al., 2010). В то же время, патогенность и региональные особенности возбудителей острых кишечных инфекций, обусловленных УПЭ, до сих пор изучены недостаточно.

Одним из важнейших аспектов фенотипической характеристики условно-патогенных энтеробактерий является их резистентность к антимикробным препаратам (АМП) (Страчунский Л.С., 2002; Cкала Л.З. с соавт., 2004; Tenover F.C., 2005). При этом, как отмечает А.Е. Билев (2011), массовое распространение антибиотикорезистентных штаммов в популяциях условно-патогенных микроорганизмов стало важной проблемой клинической медицины, в связи с их более высокими адаптационными возможностями по сравнению с возбудителями классических инфекций.

На фоне информации о роли условно-патогенных микроорганизмов в инфекционной патологии человека недостаточно изученной остается проблема их циркуляции в природных, в частности, водных экосистемах. Между тем, адаптивные возможности бактерий данной группы и, соответственно, их потенциальные местообитания, экологические ниши, механизмы и формы существования в природе необычайно широки и многообразны (Бухарин О.В., 1997). Особое значение имеет изучение циркуляции бактерий данной группы в водных объектах, оказывающих существенное влияние на жизнедеятельность человеческой популяции (Мамонтова с соавт., 2000). Условно-патогенные микроорганизмы способны не только длительно обитать в субстратах внешней среды, в частности, в воде, но и накапливаться в ней. Выживанию и накоплению микроорганизмов в объектах внешней среды, в т.ч. в воде, способствуют факторы персистенции (Макаров В.Ю., 2007). Также у водных штаммов УПЭ выявлены адгезивная и гемолитическая активность, описаны ферменты ДНКаза, гиалуронидаза, некоторые протеиназы (Кравченко О.С., 2009; Езепчук Ю.В., 1997; Kielleberg S.,1985), резистентность к антимикробным препаратам (Загайнова А.В., 2010). Усиливающееся антропогенное воздействие на водные экосистемы определяет необходимость изучения биологических свойств УПЭ с позиций оценки их потенциальной эпидемической опасности и влияния на состояние микробиоценозов природных водоемов. В рамках изучения биологической активности УПЭ важное значение имеет выявление их адаптационных возможностей, способствующих выживанию в различных условиях среды обитания.

Исходя из вышеизложенного целью работы является: выявить доминирующие популяции, фенотипические и генотипические характеристики, адаптационный потенциал условно-патогенных энтеробактерий на моделях острых кишечных инфекций и водных экосистем для оценки их медико-экологической значимости.

Для выполнения указанной цели поставлены следующие задачи:

1. Изучить спектр условно-патогенных энтеробактерий, выделенных при острых кишечных инфекциях установленной этиологии, у детей Иркутской области.

2. Изучить циркуляцию бактерий данной группы в микробных сообществах водных экосистем на модели крупнейших водоемов Восточной Сибири, их таксономическую характеристику, выявить доминирующие и субдоминирующие популяции, видовое разнообразие.

3. Определить фенотипические характеристики условно-патогенных энтеробактерий, выделенных от больных ОКИ, а также из водных объектов.

4. Выявить и оценить частоту встречаемости у микроорганизмов генетических детерминант патогенности.

5. Оценить резистентность к антимикробным препаратам условно-патогенных энтеробактерий, выделенных от больных ОКИ и из водных объектов.

6. Провести анализ клинических аспектов острых кишечных инфекций, обусловленных бактериями семейства Enterobacteriaceae, их сопряженность с наличием генетических детерминант патогенности микроорганизмов.

7. Изучить адаптационный потенциал клинических и водных штаммов энтеробактерий в различных условиях существования (количественная оценка ферментативной активности, способность к образованию биопленок).

^ Научная новизна и теоретическая значимость работы

Определен таксономический спектр условно-патогенных энтеробактерий, выделяемых при ОКИ, у детей Иркутской области, его смена в многолетнем аспекте, выявлены субдоминирующие популяции, изучены патогенные свойства, дана оценка влияния факторов патогенности на клинико-эпидемиологические особенности острых кишечных инфекций.

Полученные данные о фенотипических маркерах условно-патогенных энтеробактерий вносят вклад в изучение патогенности бактерий данной группы, их участия на различных этапах инфекционного процесса.

Определены генетические маркеры УПЭ, информативные при оценке их этиологической значимости при ОКИ (hlyA, hlyB, sfaA, sfaG, fimA, irp-2). Показаны различия в частоте встречаемости генов патогенности у различных видов представителей семейства Enterobacteriаceae.

Показана значимость условно-патогенных энтеробактерий, их биологической активности, персистентного потенциала, распространенности генетических маркеров патогенности среди водных изолятов для оценки потенциальной опасности водной среды.

Получены данные об адаптационных возможностях УПЭ (вариабельность ферментативного аппарата УПЭ, способность к формированию биопленочных сообществ), что позволяет внести вклад в решение проблемы по изучению их адаптации к различным условиям обитания.

^ Практическая значимость

Определены основные виды условно-патогенных представителей семейства Enterobacteriаceae в структуре ОКИ и маркеры их патогенности, существенно важные с клинической точки зрения.

Данные, полученные при определении фенотипических и генотипических факторов патогенности бактерий указанной группы, вносят вклад в оценку их этиологической и эпидемиологической значимости.

Мониторинг антибиотикоустойчивости УПЭ позволяет создать паспорт резистентности возбудителей ОКИ и бактерий, выделенных из водных экосистем.

Разработанный способ определения гетерогенности микробных популяций по показателю антибиотикорезистентности УПЭ позволяет проводить оценку их потенциальной опасности и расширить возможности биотестирования водных экосистем.

Данные по изучению микробиоценозов крупнейших водоемов Восточной Сибири могут быть использованы в качестве базовой информации для мониторирования водных экосистем.

Внедрения. Материалы исследований используются в практике работы ТУ Федеральной службы в сфере защиты прав потребителей и благополучия человека по Республике Саха (Якутия) для целей микробиологического мониторинга поверхностных водоемов; в практике работы Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Иркутской области для целей эпидемиологического надзора за острыми кишечными инфекциями; внедрены в учебный процесс на кафедре эпидемиологии и микробиологии ГБОУ ДПО «Иркутская государственная медицинская академия последипломного образования» (акт внедрения №16 от 22.10.2011). Результаты исследований использованы при издании учебных пособий для врачей: «Микробиологический мониторинг водных экосистем» (2008); «Техногенное загрязнение окружающей среды и инфекционная патология (клинико-эпидемиологические обобщения)» (2008); «Проявление инфекционной патологии в условиях техногенного загрязнения окружающей среды» (учебное пособие для системы послевузовского профессионального образования врачей, утввержденный УМО по медицинскому и фармацевтическому образованию вузов России (УМО -17-28/78 от 26.02.2010), методических рекомендаций для врачей «Выявление факторов риска в эпидемиологическом анализе» (2011).

По результатам исследований получены Свидетельства Федеральной службы по интеллектуальной собственности, патентам и товарным знакам (РОСПАТЕНТ) о гос. регистр. БД № 2010620379 от 14.07.2010г. «Биопрофиль условно-патогенных энтеробактерий - возбудителей острых кишечных инфекций у детей»; № 2010620552 от 24.09.2010г. «Таксономическая характеристика и биологические свойства условно-патогенных микроорганизмов водных экосистем»; № 2011620192 от 11.03.2011г. «Клинико-эпидемиологические особенности острых кишечных инфекций, обусловленных условно-патогенными микроорганизмами»; № 2011620513 от 13.07.2011г. «Антибиотикоустойчивость аутохтонных и аллохтонных представителей микробного сообщества водных экосистем».

Положения, выносимые на защиту:

  1. Основными представителями условно-патогенных энтеробактерий в структуре бактериальных ОКИ установленной этиологии являются бактерии родов Enterobacter, Proteus, Klebsiella и Citrobacter (класс субдоминант). Данные виды энтеробактерий (а также E.coli) преобладают (с изменением степени доминирования) и в таксономическом спектре грамотрицательной составляющей микробиоценозов водных экосистем.

2. Условно-патогенные бактерии семейства Enterobacteriaceae характеризуются выраженной фенотипической и генотипической гетерогенностью, что необходимо учитывать при оценке их этиологической и эпидемиологической значимости.

3. Условно-патогенные энтеробактерии, выделенные от больных ОКИ, несут генетические маркеры патогенности, детерминирующие важные этапы взаимодействия возбудителя с клетками организма хозяина: адгезию, продукцию гемолизинов, размножение в тканях (hlyА, hlyВ, sfaA, sfaG, fimA, irp-2). Наличие у клинических штаммов энтеробактерий генетических детерминант патогенности сопряжено с утяжелением клинической картины заболевания.

4. Распространенность условно-патогенных энтеробактерий, их таксономическая характеристика, степень доминирования, биологическая активность, персистентный потенциал, наличие генетических маркеров патогенности, антибиотикоустойчивость являются индикаторами степени потенциальной опасности водных микробиоценозов.

5. Условно-патогенные бактерии семейства Enterobacteriaceae (клинические и водные изоляты) характеризуются адаптационным потенциалом, отражающимся качественными и количественными проявлениями ферментативной активности, а также способностью к формированию биопленочных сообществ.

^ Апробация работы

Материалы диссертационной работы были представлены на: Российской научно-практ. конференции, посвящ. 100-летию профессора Е.В. Талалаева «Оценка современного состояния микробиологических исследований в Восточно-Сибирском регионе» (Иркутск, 2002); Межрегиональной научно-практ. конференции «Биология микроорганизмов и их научно-практическое использование» (Иркутск, 2004); научно-практической конференции «Здоровье населения Иркутской области: проблемы и пути решения» (Иркутск, 2003); I межрегиональном семинаре «Организация санитарно-эпидемиологического мониторинга за острыми кишечными инфекциями» (Иркутск, 2006); научно-практ. конференции «Оценка эколого-экономической ситуации загрязнения водных экосистем в бассейне оз. Байкал и управление экологическим риском» (Иркутск, 2006); научно-практ. конференции «Среда обитания человека и санитарно-эпидемиологическое благополучие населения» (Улан-Удэ, 2006, Управление Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по республике Бурятия); III Российской научной конференции с международным участием «Проблемы инфекционной патологии в регионах Сибири, Дальнего Востока и Крайнего Севера» (Новосибирск, 2006); Всероссийской научно-практ. конференции «Здоровая семья- здоровый ребенок», посв. 20-летию образования Института педиатрии и репродукции человека СО РАМН (Иркутск, 2009); Всероссийском пленуме Научного совета по экологии человека и гигиене окружающей среды РАМН и Минздравсоцразвития РФ (Москва, 2009, ГУ НИИ ЭЧ И ГОС им. А.Н.Сысина РАМН); научной конференции с международным участием «Этиологические, эпидемиологические и клинические аспекты инфекционных болезней» (к 90-летию кафедры микробиологии, вирусологии и иммунологии Иркутского государственного медицинского университета) (Иркутск, 2010); региональной научно-практ. конференции с международным участием «Актуальные вопросы инфекционной патологии» (Иркутск, 2010); III межрегиональном семинаре «Организация санитарно-эпидемиологического мониторинга за острыми кишечными инфекциями» (Иркутск, 2010); международной конференции «Проблемы экологии». Чтения памяти профессора М.М. Кожова (Иркутск, 2010); II Международной научно-практ. конференции «Экология, здоровье, спорт» (Чита, 2010); международной конференции «Экология и геохимическая деятельность микроорганизмов экстремальных местообитаний» (Улан-Удэ, 2011); всероссийской научно-практ. конференции с междунар. участием «Окружающая среда и здоровье населения» (г. Иркутск, 2011); всероссийской научно-практ. конференции с междунар. участием «Актуальные проблемы эпидемиологии на современном этапе» (Москва, 2011); Пленуме Научного совета по экологии человека и гигиене окружающей среды «Актуализированные проблемы здоровья человека и среды его обитания и пути их решения» (Москва, 2011).

Публикации

Основные положения диссертационной работы нашли отражение в 58 научных публикациях, в т. ч. в журналах, рекомендованных ВАК для публикации материалов докторских диссертаций - 21, монографиях - 2, пособиях для врачей - 3, из них утвержденных УМО по медицинскому и фармацевтическому образованию вузов России - 1, методических рекомендациях для врачей-1, базах данных, получивших Свидетельства РОСПАТЕНТа – 4.

^ Структура и объем диссертации

Диссертация состоит из введения, обзора литературы, описания материалов и методов, результатов собственных исследований, отраженных в 7 главах, главы обсуждения полученных материалов, выводов, списка использованных источников литературы. Работа изложена на 302 страницах, иллюстрирована 112 рисунками и 25 таблицами. Список литературы содержит 398 работ, из них 295 отечественных и 103 зарубежных авторов.


^ СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы

В работе представлены результаты изучения УПЭ, выделенных от детей, больных ОКИ, поступивших на лечение в Иркутскую областную инфекционную больницу; от здоровых детей, посещающих детские дошкольные учреждения (2006-2010 гг.); из вод крупнейших водоемов Восточной Сибири и Севера: река Ангара (Иркутская область), река Лена на всей ее протяженности, от верховья (Иркутская область) до впадения в море Лаптевых (Республика Саха (Якутия) (1999-2008 гг). Анализ заболеваемости острыми кишечными инфекциями, в т.ч. обусловленной УПЭ, проводили по материалам Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Иркутской области (2000-2010 гг.); клинического течения ОКИ - с использованием медицинской карты стационарного больного (2006-2010 гг.). Объем выполненных исследований приведен в таблице 1.

Таблица 1

Объекты и объем выполненных исследований



Направление исследований

Количество

копрофильтраты детей

водные объекты

всего

больные ОКИ

здоровые

Антибиотикоустойчивость

1695

128

8518

10341

Антилизоцимная активность

924

128

504

1556

Продукция ДНК-азы

924

128

504

1556

Гемолитическая активность

924

128

504

1556

Адгезивная активность

924

128

504

1556

Протеолитическая активность

924

128

504

1556

Продукция фосфатазы

924

128

504

1556

Молекулярно-генетические

исследования (кол-во штаммов/кол-во исследований)

175/1050


65/390

89/623


329/2063

Определение вирулентности (внутрибрюшинная проба) (кол-во штаммов/кол-во животных)

15/45

5/15

9/27

29/87

Экспериментальные исследования по количественному определению ферментативной активности УПЭ



168



«-»



168



336

Экспериментальные исследования по определению способности образовывать биопленки

240

120

120

480

Анализ заболеваемости острыми кишечными инфекциями (2000-2010 гг.)










инф.бюллетени-14

Анализ многолетней динамики частоты встречаемости УПМ (2000-2010 гг.)










штаммы УПМ - 5924

Анализ клинического течения ОКИ (2006-2010 гг.)










ст.уч.ф. №0003/у-931

Прим.: «-»-исследования не проводились

Отбор проб воды, фильтрацию через мембранные фильтры, выделение культур микроорганизмов, их идентификацию проводили по общепринятым методикам (Приказ МЗ СССР № 535 от 22.04.85; «Энтеробактерии»…, 1985; Краткий определитель Берджи, 1997; Поздеев О.К., 2002; Марри П.Р., 2006). Биохимические свойства микроорганизмов определяли с помощью коммерческих тест-систем «Enterotest» фирмы Lachema (Чехия). Для выборочной идентификации использовали баканализатор Sceptor (Becton Dickinson, USA). Определение щелочной фосфатазы, продукции ДНК-азы, протеолитической и гемолитической активности осуществляли согласно стандартным методам («Частная медицинская микробиология…» под ред. А.С. Лабинской, 2005), адгезивной активности - по методу С.С. Гизатулиной с соавт. (Способ оценки…, 1991), персистентных свойств - по методике О.В.Бухарина (Бухарин О.В., 1999; Метод. рекомендации…, 2001). Определение антибиотикорезистентности микроорганизмов и оценку результатов проводили согласно МУК 4.2.1890-04.

Оценку вирулентности in vivo проводили по способности вызывать гибель белых мышей путем введения в/б 0,5 мл суспензии белым мышам в количестве трех для каждой бактериальной культуры, отмечая изменения через 6, 24, 48 и 72 часа и 10 суток (Методические указания…, 1999). Эксперименты выполняли на беспородных белых мышах (весом 14-15 г) в соответствии с «Правилами проведения работ с использованием экспериментальных животных", утвержденными МЗ СССР (1977г.), «Международными рекомендациями по проведению медико-биологических исследований с использованием животных» (1986г.).

Для определения количественных показателей ферментативной активности исследуемые микроорганизмы культивировали при нескольких температурных режимах: 4оС, 24оС, 30оС и 37оС. Использовали две питательные среды: 1) необогащенная среда - физраствор, забуференный 0.1 М фосфатным буфером, или так называемая "голодная" питательная среда; 2) обогащенная среда Красильникова или полная синтетическая среда. Количественное определение ферментативной активности микроорганизмов проводили в соответствии с общепринятыми методиками: Mn-пероксидазную – по НАДН (Asada Y. et al., 1987); липазную - по олеиновой кислоте, уреазу - по мочевине (Хазиев Ф.Х., 1990). Активность каталазы определяли спектрофотометрически по убыли 0.06 М Н2О2 в растворе, содержащем Н2О2, культуральный фильтрат и 0.05 М фосфатный буфер рН 7.0.

Определение формирования биопленок штаммами условно-патогенных энтеробактерий проводили по методике И.А. Шагинян с соавт. (2007).

Молекулярно-генетические методы. Экстракцию тотальной бактериальной ДНК из бактериальных суспензий исследуемых микроорганизмов (107 КОЕ/мл) проводили согласно Методическим рекомендациям по детекции… (1998). Для ПЦР амплификации использовали стандартный набор «АмплиСенс-1» (пр-во ФГУН ЦНИИЭ Роспотребнадзора), амплификатор «Mastercycler» (фирма «Eppendorf»). Подбор температуры отжига праймеров осуществляли экспериментальным путем, а также используя данные литературы (Бондаренко В.М. с соавт., 2004; Фиалкина С.В., 2004; Жеребцова Н.Ю., 2006; Вершинин А.Е.,2008) и рекомендации НПФ «Литех». На один образец использовали 15 мкл реакционной смеси : 5-x РСR- буфер 3,0; MgSO4 – 1,0; dNTP -1,0; олигонуклеотидные праймеры – по 1,0; Tag-полимераза – 0,2; исследуемая проба- 5,0; деионизированная вода – 2,8.

Бактерии тестировали методом ПЦР на наличие генов вирулентности. Использовали праймеры к ряду генов, обнаруженных в составе «островков» патогенности E.coli, контролирующих адгезию S типа (sfaA-(F1) 5'-cggtgtgcgtagttcaat-3', (R1) 5'-cacccgcatggataaaaa-3'; sfaG-(F2) 5'-tgccgggaacacagaccatag-3', (R2) 5'-caatcttgataccgccagcattc-3') и 1 типа (fim A-(F3) 5'-сgacgcatcttcctcattcttct-3', (R3) -5'-attggttccgttattcagggttgtt-3'); продукцию гемолизинов (hlyA-(F4) 5'- cacgcgtgccgacaagtt-3', (R4)-5'- gccacatcccggaaatcaat-3'; hlyВ – (F5)-5'- cgacgtcgccttgatgata –3', (R5)-5'-tccccctgcttaatactgagat-3'); синтез железорегулируемого белка (irp-2 - (F6)-5'-gttgctgtccatcaagcacg -3', (R6)- 5'- gccggaaagcctggccttta -3'). Праймеры синтезированы в НПФ «Литех» (г. Москва). Анализ продуктов ПЦР проводили гель-электрофорезом в агарозе (камера электрофоретическая «SE-2»). Использовали агарозу производства «Sigma» (США) на трис-боратном буфере, добавляли 1% р-р бромистого этидия. Амплифицированный фрагмент идентифицировали по размеру, используя для сравнения маркер молекулярного веса ДНК Gene Ruler 100 bр DNA Ladder Plus. Результаты документировали с использованием видеосистемы гель-документирования и программы «Gel Imager».

Статистические методы. Статистическую обработку эпидемиологических данных и результатов микробиологических исследований проводили с применением общепринятых параметрических и непараметрических критериев статистики (Ашмарин Н.П. с соавт., 1962; Лакин Г.Ф., 1980; Гланц С., 1999; Савилов Е.Д. с соавт., 2004; 2011). Для анализа эпидемиологической обстановки по ОКИ применяли интегральный статистический критерий – суммарный индекс эпидемиологической ситуации (ИЭС) (Методический подход…, 2011). Для количественной оценки степени доминирования микроорганизмов, принадлежащих к различным таксономическим группам, использовали шкалу Е.Л. Любарского (Баканов А.И., 1987); для оценки микробиоценозов водных экосистем - коэффициент Серенсона (S) (Одум Ю., 1975), для определения разнообразия – индекс видового разнообразия Margalef (d) (Margalef R., 1958). Показатель «Л», характеризующий состояние системы «лизоцим-антилизоцим», определяли как соотношение числа лизоцимактивных и антилизоцимактивных микроорганизмов (Плотников А.О., с соавт., 2000). Оценку гетерогенности микробных популяций и состояния микробиоценозов водных экосистем проводили в соответствии с разработанным способом по показателю антибиотикорезистентности (ИАР) с позиции кластерной структурированности.


^ Результаты исследований и их обсуждение


Заболеваемость и спектр возбудителей острых кишечных инфекций у детей Иркутской области

Анализ заболеваемости ОКИ установленной этиологии в Иркутской области за период 2000-2010гг. выявил ее значимый рост (p<0,01), в т.ч. и у детей до 14 лет, что отражает эпидемиологическую ситуацию в РФ за последние годы. В возрастной структуре заболевших ОКИУЭ имело место увеличение доли детей до 14 лет (p<0,01). Одновременно отмечалось значимое повышение уровня заболеваемости ОКИ бактериальной этиологии (коэффициент регрессии +11,80/000; p<0,05). Эпидемиологическая ситуация по ОКИ бактериальной этиологии в Иркутской области достигла «порогового» уровня (0,92) в начале анализируемого периода (2000г.) и оставалась относительно стабильной до 2004 г. Ухудшение ситуации отмечено в период с 2005 по 2008 гг., когда показатели индекса эпидемиологической ситуации превышали «пороговые» значения (1,08-1,12).

Изучение спектра микроорганизмов, выделяемых при острых кишечных инфекциях, показало преобладание УПМ, которые значимо (p<0,01) превышали долю патогенов (1,5±0,1%) и вирусных агентов (43,2±1,4%) и обусловливали более половины всех ОКИУЭ (55,3±0,4%). Среди условно-патогенных возбудителей ОКИ абсолютно доминировали представители семейства Enterobacteriaceae (около 90%). Спектр условно-патогенных энтеробактерий был представлен бактериями родов Proteus, Enterobacter, Citrobacter, Klebsiella, Morganella, Hafnia, Kluyvera, Serratia, Providencia и Pantoea. На смену состава условно-патогенных энтеробактерий, в первую очередь, оказывало влияние содержание бактерий родов Proteus, Enterobacter, Citrobacter, Klebsiella, Morganella, составивших около 95% всех представителей данного семейства.

За период наблюдения (2000-2010 гг.) спектр условно-патогенных энтеробактерий, выделенных при острых кишечных инфекциях, претерпел существенные изменения, характеризующиеся значимым увеличением доли Klebsiella spp. (r=0,79; р<0,01), тенденцией к росту доли Enterobacter spp., варьированием (с тенденцией к снижению) частоты встречаемости Proteus spp., Citrobacter spp. и Morganellа spp. (рис.1).



Рис.1. Таксономический и количественный спектр условно-патогенных энтеробактерий, выделенных от детей, больных острыми кишечными инфекциями, за 2000-2010 гг. (%)

Выявлены изменения в распределении УПЭ по классам доминирования. В 2000 г. в класс субдоминант (границы класса по доле от 36% до 14%) входили только энтеробактерии родов Proteus и Citrobacter, прочие представители семейства Enterobacteriaceaе (Klebsiella, Enterobacter и Morganella) относились к второстепенному классу (границы класса по доле от 14% до 6%). В конце исследуемого периода произошли существенные изменения в таксономическом составе условно-патогенных энтеробактерий, а именно: представители родов Klebsiella и Enterobacter, согласно доли бактерий каждого рода в общей численности, перешли в класс субдоминант, а Morganellaв редкий класс (границы класса по доле от 6 до 0%). Таким образом, в 2010 г. при отсутствии абсолютных доминант и доминант, спектр УПЭ, выделенных от больных острыми кишечными инфекциями, был представлен субдоминирующими бактериями родов Enterobacter, Proteus, Klebsiella и Citrobacter (табл.2).

Таблица 2

Оценка степени доминирования бактерий семейства Enterobacteriaceaе, выделенных от больных острыми кишечными инфекциями (по шкале доминирования)

Балл

Класс (по степени доминирования)

Границы классов по доле рода


Родовая принадлежность микроорганизма

2000г.

2010г.

5

Абсолютный доминант

64 < N <100

«-»

«-»

4

Доминант

36 < N < 64

«-»

«-»

3

Субдоминант


14 < N < 36

Proteus Citrobacter

Proteus

Citrobacter

Klebsiella

Enterobacter

2

Второстепенный


6< N <14

Klebsiella

Enterobacter

Morganella




1

Редкий

0< N< 6

другие

Morganella, другие


^ Прим. : «-»- отсутствие

Фенотипические и генотипические маркеры патогенности условно-патогенных энтеробактерий

Определение фенотипических признаков у условно-патогенных энтеробактерий позволяет, во-первых, проводить мониторинг патогенности бактерий данной группы, во-вторых, является (наряду с другими) критерием их этиологической значимости. Современный уровень изучения биологических свойств микроорганизмов показывает, что, как отмечает В.М. Бондаренко (2011), количественный критерий не всегда определяет способность изолята вызывать заболевание, которое в большей степени связано с реализацией патогенного потенциала возбудителя. Для каждого вида возбудителей характерен комплекс маркеров (фенотипических и генотипических) патогенности, благодаря которым осуществляется развитие инфекционного процесса.

Проведенная комплексная оценка фенотипических признаков клинических штаммов энтеробактерий, коррелирующих с их патогенностью, позволила установить, что исследуемыми фенотипическими свойствами обладала значимо большая часть (p<0,01) протестированных штаммов. При этом у 50,9±1,6% исследованных микроорганизмов отмечены персистентные свойства - антилизоцимная активность, направленная на инактивацию факторов естественной резистентности организма человека; около 40% штаммов продуцировали щелочную фосфатазу, способствующую увеличению проницаемости клеточных мембран, и обладали адгезивной активностью, направленной на прикрепление и колонизацию эпителиоцитов слизистых оболочек. Данные свойства встречались значимо чаще (р<0,05) по сравнению с другими признаками. У третьей части микроорганизмов отмечены протеолитическая и гемолитическая активность, оказывающая повреждающее действие на клеточные мембраны; у 26,5±1,4%-способность экспрессировать фермент патогенности ДНКазу, вызывающий повреждение структуры нуклеиновых кислот (рис. 2).




Рис. 2. Частота встречаемости свойств, коррелирующих с патогенностью, среди УПЭ, выделенных из фекалий больных ОКИ (%)

Выявлена видовая и межродовая неоднородность клинических штаммов энтеробактерий по наличию фенотипических маркеров патогенности (рис.3).



Рис.3. Биопрофиль клинических штаммов УПЭ по фенотипическим маркерам патогенности

Так, среди различных представителей энтеробактерий более высокая (p<0,05) частота встречаемости фосфатазной и протеолитической активности отмечена у штаммов Proteus spp. (при этом большим уровнем ферментативной активности обладали штаммы P.mirabilis), адгезивной активности - у штаммов Enterobacter spp. (преимущественно за счет E.aerogenes) и гемолитической - у Klebsiella spp. (данный признак среди штаммов K.pneumoniae встречался в два раза чаще, чем среди K.oxytoca). Антилизоцимная активность чаще (p<0,05) отмечалась у Klebsiella spp., Citrobacter spp. и M.morganii, продукция ДНКазы- у Klebsiella spp. и Proteus spp.

Проявленная условно-патогенными энтеробактериями гетерогенность по фенотипическим маркерам позволила условно разделить их на четыре группы: 1 - штаммы, характеризующиеся наличием более двух маркеров; 2 - штаммы, с двумя маркерами; 3 - одним маркером; 4 группа - не обладающие исследованными свойствами. Установлено, что значимо чаще встречались клинические штаммы энтеробактерий, у которых отмечалось более двух фенотипических признаков (39,4±1,6%). В то же время были выделены микроорганизмы, характеризующиеся отсутствием фенотипических маркеров - 9,5±1,% (рис.4).



Рис. 4. Ранжирование клинических штаммов условно-патогенных энтеробактерий по наличию фенотипических признаков

Среди бактерий родов Proteus и Klebsiella значимо преобладали штаммы с наличием более двух фенотипических признаков (67,1±2,6% и 54,4±3,0% соответственно), а у Enterobacter и Citrobacter - с двумя признаками (57,9±5,6% и 54,3±4,2%). Наличие самого большого комплекса (пяти из шести исследуемых) фенотипических маркеров патогенности значимо чаще выявлялось у штаммов Klebsiella spp. (8,8±1,7%).

В то же время среди энтеробактерий, полученных от здоровых детей, значимо чаще отмечались штаммы четвертой группы (около 70%), пятая часть штаммов (22,7±3,7%) характеризовалась одним фенотипическим признаком; 7,8±2,4% - двумя признаками и не было выявлено штаммов с сочетанием более двух признаков. Также установлено, что спектр фенотипических признаков среди клинических штаммов энтеробактерий оказался значительно шире (пять маркеров) по сравнению со штаммами контрольной группы (два маркера).

Таким образом, проведенные исследования показали, что условно-патогенные энтеробактерии, выделенные от больных ОКИ, крайне гетерогенны по наличию фенотипических признаков; среди них преобладают штаммы, которым свойственно наличие комплекса факторов патогенности, при этом каждый десятый штамм не обладает фенотипическими маркерами, необходимыми для проявления патогенности.

Патогенность клинических штаммов in vivo – наиболее признанный маркер их этиологической значимости. Проведенная оценка вирулентности клинических штаммов энтеробактерий in vivo показала, что при тестировании 13 культур (K.pneumoniae -5, P.mirabilis -2, P.vulgaris -1, M.morganii-2, E.cloacae-2, С.freundii -1), обладающих комплексом фенотипических признаков, гибель 88,2% мышей наблюдалась через 24 часа, 11,8% - через 48 часов. Штаммы энтеробактерий, изолированные от больных ОКИ, характеризующиеся отсутствием маркеров патогенности, в течение 10-дневного наблюдения не вызывали гибели лабораторных животных. Штаммы энтеробактерий, выделенные от здоровых детей, характеризующиеся отсутствием маркеров патогенности, также не вызывали гибели лабораторных животных.

Исследования последних лет показывают эффективность индикации у условно-патогенных энтеробактерий генетических маркеров патогенности с помощью молекулярно-генетических методов, в частности, ПЦР. В связи с этим проведено изучение наличия и распространенности генетических маркеров патогенности у клинических штаммов условно-патогенных энтеробактерий. Для определения нуклеотидных последовательностей генов, контролирующих продукцию факторов патогенности, использовали праймеры, амплифицирующие фрагменты sfaA и sfaG генов, детерминирующих продукцию фимбрий S типа, гена fimA, обеспечивающего синтез фимбрий l типа; hlyA и hlyB генов, контролирующих продукцию токсических веществ - гемолизинов; irp-2 гена, детерминирующего синтез сидерофора, участвующего в транспорте железа внутрь клетки. Тестирование коллекции из 175 штаммов УПМ показало, что у 41 изолята (23,4±3,2%) выявлены нуклеотидные последовательности генов, кодирующих фимбриальные факторы адгезии, продукцию гемолизинов и синтез железорегулируемого белка. При этом генетические детерминанты патогенности обнаружены у бактерий восьми родов (рис.5).




Рис. 5. Спектр клинических штаммов энтеробактерий с наличием генетических детерминант патогенности (в %)

Установлено, что чаще встречались гемолитические детерминанты (hlyA и (или) hlyB -13,4±2,6%), вызывающие цитопатические изменения и являющиеся одним из важнейших факторов вирулентности энтеробактерий, и генетические детерминанты адгезивной активности энтеробактерий S типа и (или) 1 типа - 11,7±2,4%. Частота выявления нуклеотидных последовательностей генов, ассоциированных с продукцией гемолизинов и адгезией, оказалась значимо более высокой (p<0,01) по сравнению со встречаемостью других исследуемых генов. Так, в пуле исследуемых культур искомые ампликоны при использовании праймеров к hlyA и hlyB определены у 17 штаммов (9,7±2,2%), sfaА- 13 (7,4±1,9%); sfaG- 8 (4,6±1,5%), fim A- 4 (2,3±1,1%), irp-2 (1,2±0,3%) (рис.6).



Рис.6. Частота обнаружения генетических маркеров «островов» патогенности среди условно-патогенных энтеробактерий, выделенных от больных ОКИ (n=175)


Проведенные исследования показали генетическую неоднородность популяции клинических штаммов энтеробактерий по признаку патогенности. Установлено, что среди УПЭ, обладающих генетическими детерминантами патогенности, наибольшую долю составили Klebsiella spp. и Citrobacter spp. (39,0 % и 24,4% соответственно среди штаммов с наличием генетических маркеров патогенности; 9,1±2,1% и 5,7±1,7% соответственно среди всех протестированных УПЭ). Кроме того, клинические штаммы Klebsiella spp., значимость которых в этиологии ОКИ в последние годы возрастает, несут самый большой набор генетических детерминант патогенности по сравнению с другими энтеробактериями (рис.7).



^ Прим.: 1- доля среди клебсиелл; 2- доля среди всех протестированных энтеробактерий

Рис.7. Частота обнаружения генетических детерминант патогенности у клинических штаммов Klebsiella spp.

У Klebsiella spp. выявлены практически все изучаемые генетические маркеры «островов» патогенности. При этом наибольшая частота обнаружения была характерна для нуклеотидных последовательностей генов hlyA и sfaG

Бактерии рода Cirtobacter также характеризовались довольно большим набором генетических детерминант «островов» патогенности. У данных штаммов выявлены нуклеотидные последовательности генов, ассоциированных с продукцией гемолизинов (hlyB и hlyA), а также адгезией S типа (sfa A) и адгезией 1 типа (fimA). Среди бактерий рода Kluyvera (вид K.ascarbata) выявлены hlyB, hlyA и sfaA. У клинических штаммов Enterobacter spp. установлены ампликоны, гомологичные hlyA и sfaA генам, ответственным за продукцию гемолизинов и адгезивную активность S типа, при этом hlyA обнаружен у E.aerogenes, sfaA – у E.сloacae и E. intermedius. Штаммы M. morganii и P. agglomerans характеризовались только наличием генетических детерминант «островов» патогенности, ответственных за продукцию гемолизинов.

Установлена неравномерность распространенности генетических детерминант патогенности у культур, полученных от детей разных возрастных групп. В большинстве случаев (85,3%) маркеры «островов» патогенности были обнаружены у культур, выделенных от детей до 3-х лет (группа риска). Кроме того, у клинических штаммов, выделенных от детей до 3-х лет, отмечен самый широкий набор генетических детерминант патогенности. Так, у культур данной возрастной группы выявлены 100% детерминант sfaG, fimA и irp-2; а также 88,2%- hlyB, 82,3% - hlyA, 76,9% - sfaA. Результаты по выявлению генетических маркеров патогенности у культур, выделенных от больных разных возрастных групп, сопоставимы с исследованиями Н.Ю. Жеребцовой. Данным автором при выявлении нуклеотидных последовательностей hlyA, hlyB, sfaG, cnfl, estB генов также показано, что на культуры, полученные от детей до 3-х лет, приходилась самая большая доля данных детерминант.

Следует отметить, что среди энтеробактерий, изолированных от детей контрольной группы, встречаемость генов оказалась значимо более низкой и характеризовалась единичными находками (гены hlyA -3,1% и sfa -1,5%).





оставить комментарий
страница1/3
Кулеш Д.В
Дата11.08.2012
Размер0.7 Mb.
ТипДиплом, Образовательные материалы
Добавить документ в свой блог или на сайт

страницы:   1   2   3
хорошо
  1
отлично
  1
Ваша оценка:
Разместите кнопку на своём сайте или блоге:
rudocs.exdat.com

Загрузка...
База данных защищена авторским правом ©exdat 2000-2017
При копировании материала укажите ссылку
обратиться к администрации
Анализ
Справочники
Сценарии
Рефераты
Курсовые работы
Авторефераты
Программы
Методички
Документы
Понятия

опубликовать
Загрузка...
Документы

Рейтинг@Mail.ru
наверх